Nine stable transformant clones secreting human IgG1 were generated, three of which were expanded for Ab production

Nine stable transformant clones secreting human IgG1 were generated, three of which were expanded for Ab production. full germ-line revertant counterpart was entirely dependent on the mutations in the VH not those in the Vchain. Third, we decided, by site-directed mutagenesis experiments, that of the three mutations in the mAb13 VH segment (SerGly, SerThr, and SerArg at positions 31, 56, and 58, respectively), only Arg58 was crucial in increasing the mAb13 Avrel (from 1.44 10?8 to 5.14 10?9 g/gene sequences of human-specific anti-insulin IgG NU 9056 autoantibodies derived from patients with insulin-dependent diabetes mellitus (IDDM)4 treated with human recombinant insulin (12, 13). When compared with those of the closest germ-line genes, the IgG mAb Ig VH and Rabbit polyclonal to AGBL3 Vgenes displayed a number of differences that are consistent in nature and distribution with those resulting from an Ag-driven clonal selection (13). In one IgG mAb, designated mAb13, these nucleotide differences were formally proved to represent somatic point-mutations by differentially targeted PCR amplification and Southern blot hybridization of the genomic DNA from your mAb13-generating cell collection and autologous PMN (13). The higher and lower numbers of amino acid alternative (R) mutations in the VH segment CDRs and FRs, respectively, than those expected by chance alone, were consistent with exertion of a positive antigenic pressure to mutate the structure of the CDRs and to preserve that of the FRs (14C17). To analyze the structural correlates underlying the insulin-dependent emergence of the specific anti-insulin mAb13-generating cell clone, we constructed the NU 9056 germ-line revertants of the somatically mutated anti-insulin IgG mAb13 VH and Vgenes, and analyzed the Ag-binding activity of the gene products. The full germ-line revertant of mAb13 bound specifically to insulin, although with lower affinity than that of the wild-type mAb13. In addition, we analyzed the affinity for insulin of recombinant IgG1 Abdominal muscles constructed by site-directed mutagenesis and consisting of partial germ-line revertants of mAb13. We found that the somatic point mutations in the mAb13 VH, in particular the Arg at position 58, but not in the Vsegment, were crucial in increasing the binding affinity for insulin. The increased affinity for insulin mediated by the mutated Arg58 residue contrasted with the complete loss of insulin-binding resulting from the substitution of Asn52 with Lys in the same VH segment. Thus, human insulin has the potential to recruit and drive through affinity maturation natural autoantibody-producing cell clones expressing surface receptor for Ag in unmutated configuration. Materials and Methods Cloning and sequencing of the mAb13 VH and V genes The anti-human insulin IgG1 mAb13 was generated by EBV-transformation and somatic cell hybridization of peripheral B cells from an IDDM patient treated with human recombinant insulin (12). The nucleotide and deduced amino acid sequences of the mAb13 VHDJH and Vgenes have been reported (13), and are depicted in Physique 1, and segment, we NU 9056 performed PCR amplification of genomic DNA from autologous PMNs using the and Table I). The amplified products were cloned and sequenced using reported procedures (13). Open in a separate windows Physique 1 Nucleotide sequences of the wild-type and germ-line mAb13 VH, D-JH, Vand Jgene segments (gene segments (segment gene sequences are available from EMBL/GenBank under accession figures D-16832, D-16833, and D-16834, respectively. For the EMBL/GenBank accession quantity of the germ-line 13K20 gene sequence see legend to Figure 3. Table I Sequences of the oligonucleotide primers utilized for the construction of recombinant Ig V genesa Leader-mAB13VH-D-JH gene segment?H-leader (sense)5 gggaagcttctcaccatgggatgg 3?H-FR4 (antisense)5 gggctcgagactcaccTGAGGAGACAGTGACCA 3?H-Ov1 (antisense)5 GCTGCACCTCacactggacacctgcagagaaag 3?H-Ov2 (sense)5 ttctctgcaggtgtccagtgtGAGGTGCAGCTG 3Leader-mAb13Vgene segment?gene segments, respectively, have been reported (18, 19). Briefly, pcDNAIG is usually a mammalian expression vector derived from pcDNAI/Neo (Invitrogen Corp., San Diego, CA), and encodes a whole human IgG1 H chain, preceded by a murine leader sequence. The H chain leader sequence (including the leader intron), the VHDJH gene segment, and the CL chain, preceded by a murine leader sequence. The L chain leader sequence (including leader intron), the Ig Vgene segment, and the human gene are accommodated in a 1.3-kbp segment between gene for selection by methotrexate. Introduction of the mAb13 VHDJH gene segment into pcDNAIG vector The unique gene segment of mAb13 NU 9056 were amplified in individual PCR (PCR 1 and PCR 2), and joined by recombinant PCR. Primers (Ov1 and Ov2) used at the end to be joined were made complementary to one another by including nucleotides at the 5 end that are complementary to the 3 portion of the other primer (observe Table I). Primers, leader, and FR4 were designed to yield final recombinant products bearing gene segment in the.