Compared to untreated cells, monocytes treated with FAC for 24?h increased surface expression of the classical M2 marker CD206 while decreased those of the M1 markers CD86 and HLA-DR, as evaluated by flow cytometry (Fig

Compared to untreated cells, monocytes treated with FAC for 24?h increased surface expression of the classical M2 marker CD206 while decreased those of the M1 markers CD86 and HLA-DR, as evaluated by flow cytometry (Fig. source of iron. Our data showed that myeloma cell lines are able to intake and accumulate iron and thus, increasing their scavenger antioxidant-related genes and mitochondrial mass. We further demonstrated that PCs pre-treated with ferric ammonium citrate (FAC) decreased bortezomib (BTZ)-induced apoptosis and successfully engrafted in zebrafish larvae treated with BTZ. Treating human macrophages with FAC, we observed a switch toward a M2-like phenotype associated with an increased expression of anti-inflammatory markers such as ARG1, suggesting the establishment of an iron-mediated immune suppressive tumor microenvironment favouring myeloma growth. Using zebrafish larvae, we further confirmed the increase of PCs-monocytes interactions after FAC treatment which favour BTZ-resistance. Taken together our data support the hypothesis that targeting iron trafficking in myeloma microenvironment may represent a promising strategy to counteract a tumor-supporting milieu and drug resistance. and [27]. Therefore, the aim of the present work is to elucidate the significance of iron metabolism in MM cells, its effect on response to BTZ and to unravel the molecular mechanisms underlying PCs-macrophage interactions. 2.?Material and methods 2.1. Cell culture and treatments Human myeloma cell lines (U266, OPM2, NCICH929) and U937?cell line were cultured in RPMI 1640 medium supplemented with 10% FBS and 1% penicillin/streptomycin at 37?C and 5% CO2. Primary peripheral blood CD14+ monocytes were obtained by healthy donor buffy coat after separation by Ficoll-Hypaque gradient and cultured for 3 days in RPMI-1640 medium supplemented with 10% FBS and 1% Penicillin/streptomycin in presence of 10?nM Phorbol 12-myristate 13-acetate (PMA) at 37?C and 5% CO2 [28]. Based on the previous literature data [29], 15?nM BTZ (Takeda, Rome, Italy) was used in all experiments. Used dose of ferric ammonium citrate (FAC) was 100?M or 400?M [[30], [31], [32]]. 2.2. Apoptosis assay Evaluation of apoptosis was performed by flow cytometry. Samples (5??105?cells) were washed and resuspended in 100?L of phosphate-buffered saline (PBS). 1?L of Annexin V-FITC solution and 5?l of Propidium Iodide (Beckmam Coulter, made in France) were added Berbamine Berbamine to cell suspension and mixed gently. Cells were incubated for 15?min in the dark. Finally, 400?l of 1X binding buffer was added and cell preparation was analyzed by flow cytometry (MACSQuant Analyzer 10, Miltenyi Biotec). 2.3. Intracellular LIP estimation To quantify LIP, 0.5??106?cells were collected and washed with PBS. Then cells were incubated with 0,5?M calcein acetoxymethyl ester (CA-AM) (Sigma- Aldrich) for 15?min?at 37?C. After cell washing, samples were incubated with a high-affinity chelator, 100?M deferiprone (DF) (Sigma- Aldrich), at 37?C for 1?h. Cells were washed 3 times in phosphate-buffered saline (PBS) at 1500?rpm for 5?min and then analyzed by circulation cytometry (MACSQuant Analyzer 10, Miltenyi Biotec). The difference in the MFI before and after treatment with DF was used to calculate the amount of LIP (F?=?MFICA-AM/DF-MFICA-AM). 2.4. Real-time RT-PCR for gene manifestation analysis For each experiment, total RNA was extracted from cells using Trizol reagent and quantified using a UV spectrophotometer (NANODROP 1000, Thermofisher), as previously described [33]. One microgram of total RNA (in 20?L reaction volume) was reverse-transcribed in cDNA using reverse-transcriptase Rabbit Polyclonal to p130 Cas (phospho-Tyr410) (Applied Biosystem) and oligo-dT primers in a standard reaction. The quantitative real-time polymerase chain reaction (RT-PCR) of the resultant cDNA was performed using Sybr Green PCR Expert Blend (ThermoFisher Scientific) and 7900HT Fast Real-Time PCR System (Thermo Fisher) [34,35]. Manifestation of the following human being genes was evaluated: HMOX1 (FW: AAGACTGCGTTCCTGCTCAAC, RW: AAAGCCCTACAGCAACTGTCG); DMT1(FW: TGCATTCTGCCTTAGTCAAGTC, RW: ACAAAGAGTGCAATGCAGGA); FPN1 (FW: CATGTACCATGGATGGGTTCT, RW: CAATATTTGCAATAGTGATGATCAGG); ND4 (FW: ACAAGCTCCATCTGCCTACGACAA, RW: TTATGAGAATGACTGCGCCGGTGA); CYTB (FW: TCCTCCCGTGAGCGCGGTGA, RW: TTATGAGAATGACTGCGCCGGTGA); GLUT-S-TRANSFERASE (FW: CTGGGCTTCGAGATCCTGTG, RW: GGCAGACAAACTTCCACTGTC); TFAM (FW: GGTCTGGAGCAGAGCTGTGC, RW: TGGACAACTTGCCAAGACAGAT); SOD (FW: TGGTTTGCGTCGTAGTCTCC; RW: CCAAGTCTCCAACATGCCTCT); GST (Fw: CTGGGCTTCGAGATCCTGTG; Rw: GGCAGACAAACTTCCACTGTC); B2M (Fw: AGCAGCATCATGGAGGTTTG; Rw: AGCCCTCCTAGAGCTACCTG); GAPDH (Fw: AATGGGCAGCCGTTAGGAAA; Rw: GCCCAATACGACCAAATCAGAG). Gene manifestation analysis of pro-inflammatory and anti-inflammatory cytokines IL-6, CCL2, TNF, TGFB1 and ARG1 was performed using GoTaq Expert Berbamine mix (Promega) relating to manufacturer’s recommended protocol. Each reaction was run in triplicate..